Mirmira Lab real-time PCR-based
NOTE: ALL REAGENTS AND SUPPLIES MUST BE RNASE and DNASE FREE
Buffers and Solutions : All Must be RNase Free
HeLa Nuclear Extract 1X Transcription Buffer:
20 mM HEPES( pH 7.9 )
100mM KCL,
0.2mM EDTA,
0.5mM DTT,
20% Glycerol.
For 100 ml of transcription buffer:
10 ml of 200 mM HEPES pH 7.9 (4.7 gm in 100 ml
H2O. Adjust pH with NaOH**)
10 ml of 1M KCL (7.5 gm in 100 ml H2O)
40 ul of 0.5 M EDTA (18.6 gm in 100 ml pH to 8.0
with NaOH)
50 ul of 1M DTT (1.54 gm in 10 ml H2O)
5 ml 100% glycerol
Store at –70 C in 10 ml aliquots
**Adjust pH with 5M NaOH prepared in RNase free H2O (20 gm/100 ml)
Transcription Stop Solution:
20mM EDTA,
0.2M NaCl,
1% (w/v) SDS,
3ug/ml tRNA,
10ng/mL betagal plasmid (e.g. CMV-bGal)
For 100 ml of transfection stop solution:
4 ml of 0.5 M EDTA
10 ml of 2M NaCl (11.7 gm in 100 ml H2O)
10 ml of 10% SDS (w/v)
30 ul of 10 mg/ml tRNA (Sigma)
Store at –20 C in 1 ml aliquots
Protein Diluent:
10 mM Tris( pH7.5),
0.1ug/uL BSA,
5mM DTT
For 100 ml of protein diluent:
1 ml of 100X BSA (NEB)
1 ml of 1M Tris
Store in aliquots at –20 C
Add DTT just prior to use
Hela Nuclear Extract
We prepare our own Hela nuclear extract using the Dignam protocol
Template plasmid:
This can be any plasmid you want to transcribe off of. We typically use a luciferase-encoding plasmid.
MMLV Reverse Transcriptase (Invitrogen) It is critical this reagent is purchased from Invitrogen for this protocol. Other reagents may work, but we’ve noticed differences in performance.
Oligonucleotides:
RM455: (AAGCAGTGGTATCAACGCAGAGTACGCGGG) SMART primer
RM453: (CCTCTAGAGGATAGAATGGC) Reverse primer for RTPCR following in vitro transcription
RM454:
(AGCGGTTCCATCCTCTAGAG) Alternate reverse RTPCR following in vitro transcription
RM456: (AAGCAGTGGTATCAACGCAGAGT) Forward primer for RTPCR, which detects a portion of the SMART sequence. Goes with RM 453 and 454.
RM328: (TCAATCCGCCGTTTGTTCCCAC) Forward primer for Beta-gal
RM329: (TCCAGATAACTGCCGTCACTCCAAC) Reverse primer for Beta-gal
Protocol:
1. The following protocol should be optimized for the amount of Hela nuclear extract and plasmid you are using. Below is a typical example of a reaction using 25 ng of pFoxLucPrl5FF1 (P182) plasmid (you may need anywhere between 2-50 ng of plasmid). “Tube A” represents a negative (or background) control:
Tube A Tube B
1X Transcription Buffer (recipe p3): 11uL 10 uL
50 mM MgCl2 (1M MgCl Sigma) 1.5 uL 1.5 uL
P182 ( 25ng/uL) 1.0 uL 1.0uL
25X rNTPs (10 mM, Promega) 1.0 uL 1.0uL
Nuclease free water 10.5 uL 10.5uL
HeLa NE (-) 1.0uL
Total Volume: 25 ul 25ul
(Note: If you are adding purified transcription factors, then add all components except NE, wait 15 minutes, then add Hela NE).
2. Incubate for 60 mins at 30 C
3. After the transcription reaction is over , I do a DNase digestion by adding 1 ul of DNase ( 1;10 diluted in 10mM Tris pH 7.4) to each reaction . I usually incubate at 30 C for 30 mins . Then I add 250uL of transcription stop solution to kill the reaction as well as to heat inactivate the Dnase at 65 C for 15 mins .
4. Terminate the reaction by adding 250 uL stop solution and incubate for 15 mins at 65 C.
5. PCIAA extract by adding 250 uL of Phenol/Chloroform/Isoamyl Alcohol. Vortex 1 min and centrifuge for 5 min. Remove the aqueous phase (~150 uL) to a new tube and precipitate by adding 16 uL of 3M sodium acetate (pH 5.2) and 400 uL 100% ethanol at room temperature. Votex and centrifuge for 5 mins at room temperature .
6. Wash pellet by adding 1ml of 70 % ethanol , centrifuge for 5 mins, aspirate supernatant and allow pellet to air dry 5-10 minutes. Disslove pellet in 20 ul of RNase free water. The RNA at this step should now be used for cDNA preparation.
Prepare cDNA as follows:
Aliquot reagents in small Rnase free PCR tubes or strip tubes
Random Hexamer (Invitrogen) 1.0 uL
10mM dNTPS (Invitrogen) 1.0 uL
SMART Primer 2.0 uL
5X First Strand Buffer (Invitrogen) 4.0 uL
0.5 M DTT (Invitrogen) 2.0 uL
Nuclease free water 1.0 uL
RNA (prepared as above) 8.0 uL
MMLV (Invitrogen) 1.0 uL or 1 ul RNase free H2O if –RT
Total Volume 20 ul
Quick spin to get all sample to bottom of the tube.
Incubate 37 C for 50 mins, then inactivate at 70 C for 15 mins in dry bath(s) (or use a thermal cycler for this and Swarup’s RT protocol with a 4 C hold).
Reactions are now ready to be analyzed by real-time PCR
For Real Time PCR:
The 20 ul reaction mixture is diluted to 100 ul in TE and 3 ul of this dilution is used for real time PCR using primer sets 453/456 or 454/456. The normalization is done using primer set 328/329 (to amplify b-gal—this is the recovery control).